Designing Primers

"This web page was produced as an assignment for an undergraduate course at Davidson College."

 

1. Obtain coding sequence for the gene that you want to amplify with PCR

2. Start at the first ATG at the 5' end and continue until the total length is at least 20 nucleotides.

For example: IDH1: coding seq. : atgcttaacagaacaattgc

3. Check the melting temperature (Tm) of the primer using a calculator such as the one provided at this link. All of the primers should have similar temperatures so that they will anneal to the DNA at the same time because the PCR machine is set to cycle between a certain range of temperatures.

4. Add bases to the primers if some of the temperatures are too low. Now the forward primers are finished.

 

5. For the Reverse primers, go to the end of the coding sequence and starting with the last base at the 3' end, record the complementary bases moving towards the 5' end. If this is confusing, click on this link to see a movie of PCR or look at the example below.

For example: IDH1: the last 22 amino acids are: 5' caacaaattatctaccatgtaa 3'

To get the reverse primer, move from the 3' to the 5' end and write down the bases on the complementary strand.

Therefore, the reverse primer is 5' ttacatggtagataatttgttg 3'

6. Also check to make sure that the reading frame will be correct if the PCR product is going to be inserted into a plasmid or other vector.

 

The primers that were used in this lab are below:

IDH1 Forward: 5' ATGCTTAACAGAACAATTGC 3' Tm = 46 C

IDH1 Reverse: 5' TTACATGGTAGATAATTTGTTG 3' Tm = 46 C

IDH2 Forward: 5' ATGTTGAGAAATACTTTTTTTTAG 3' Tm = 45 C

IDH2 Reverse: 5' TTATAATCTCTTGATGACTG 3' Tm = 44 C

IDP1 Forward: 5' ATGAGTATGTTATCTAGAAG 3' Tm = 44 C

IDP1 Reverse: 5' TTACTCGATCGACTTGATTT 3' Tm = 46 C

IDP2 Forward: 5' ATGACAAAGATTAAGGTAGC 3' Tm = 46 C

IDP2 Reverse: 5' TTACAATGCAGCTGCCTCGA 3' Tm = 52 C

IDP3 Forward: 5' ATGAGTAAAATTAAAGTTGTTCAT 3' Tm = 45 C

IDP3 Reverse: 5' TTATAGTTTGCACATACCTT 3' Tm = 44 C

 

The PCR experiment is made possible thanks to some organisms that can survive in EXTREMELY hot temperatures and therefore, have polymerases that can too. I highly recommend that you go visit them in person ;-)

Midway Geyser in Yellowstone from Webshots <http://www.webshots.com/g/33/647-sh_1.html>


IDH Gene Homepage


Sarah's Homepage

Molecular Biology Main Page

College Home Page



Send comments, questions, and suggestions to: sahenry@davidson.edu