This web page was produced by Zack Perfect as an assignment for an undergraduate course at Davidson College

IDH1button.jpg (9996 bytes)

 

Nucleotide Sequence

1 ATGCTTAACA GAACAATTGC TAAGAGAACT TTAGCCACTG CCGCTCAGGC

51 GGAACGCACC CTACCCAAGA AGTATGGCGG TCGTTTCACC GTCACTTTGA

101 TACCTGGTGA CGGTGTTGGG AAAGAAATCA CTGATTCAGT GAGAACCATT

151 TTTGAGGCTG AAAATATCCC GATCGACTGG GAAACTATAA ACATTAAGCA

201 AACAGATCAT AAGGAAGGCG TCTATGAAGC TGTTGAGTCT CTAAAGAGAA

251 ATAAGATTGG TCTTAAGGGG CTATGGCACA CTCCTGCTGA CCAAACAGGT

301 CACGGTTCAC TAAACGTTGC TTTGCGTAAA CAACTAGATA TCTACGCCAA

351 TGTGGCCCTT TTCAAATCCT TGAAGGGTGT CAAGACTAGA ATTCCAGACA

401 TAGATTTGAT TGTCATTAGA GAAAACACGG AGGGTGAGTT CTCAGGCCTG

451 GAACATGAAT CCGTCCCTGG TGTAGTGGAA TCTTTGAAAG TTATGACTAG

501 ACCTAAGACA GAAAGGATCG CCAGATTTGC CTTTGACTTC GCCAAGAAAT

551 ACAACAGAAA GTCTGTCACA GCTGTGCATA AGGCAAATAT CATGAAGTTA

601 GGTGACGGTC TGTTCAGAAA TATAATAACT GAAATTGGCC AAAAAGAATA

651 TCCTGATATT GACGTATCGT CCATCATTGT CGACAATGCC TCCATGCAGG

701 CGGTGGCCAA ACCTCATCAA TTTGATGTCC TAGTTACCCC TTCAATGTAC

751 GGTACCATCT TAGGCAACAT TGGCGCTGCT TTGATCGGTG GTCCAGGATT

801 GGTGGCAGGT GCCAACTTTG GCAGGGACTA TGCTGTCTTC GAACCAGGTT

851 CCAGACATGT TGGTTTAGAT ATTAAAGGCC AAAATGTGGC TAACCCAACT

901 GCCATGATCC TTTCCTCCAC GTTAATGTTG AACCATTTGG GTTTGAATGA

951 ATATGCTACT AGAATCTCAA AGGCAGTTCA TGAAACGATC GCAGAAGGTA

1001 AGCATACCAC TAGAGATATT GGTGGTTCCT CTTCTACTAC TGACTTCACG

1051 AATGAAATCA TCAACAAATT ATCTACCATG TAA

 

Amino Acid Sequence

1 MLNRTIAKRT LATAAQAERT LPKKYGGRFT VTLIPGDGVG KEITDSVRTI

51 FEAENIPIDW ETINIKQTDH KEGVYEAVES LKRNKIGLKG LWHTPADQTG

101 HGSLNVALRK QLDIYANVAL FKSLKGVKTR IPDIDLIVIR ENTEGEFSGL

151 EHESVPGVVE SLKVMTRPKT ERIARFAFDF AKKYNRKSVT AVHKANIMKL

201 GDGLFRNIIT EIGQKEYPDI DVSSIIVDNA SMQAVAKPHQ FDVLVTPSMY

251 GTILGNIGAA LIGGPGLVAG ANFGRDYAVF EPGSRHVGLD IKGQNVANPT

301 AMILSSTLML NHLGLNEYAT RISKAVHETI AEGKHTTRDI GGSSSTTDFT

351 NEIINKLSTM

 

General Protein Information

 

Accession Number

6323989

Primers

Forward: 5' ATGCTTAACAGAACAATTGC 3' Tm = 46 C

Reverse: 5' TTACATGGTAGATAATTTGTTG 3' Tm = 46 C

 

Coenzyme

NAD+

 

In-frame Fusion Proteins of 6xHis

MRGS-HHHHHH-GSHVISSIVS-MLNRTIAKRTLAT

 

Six-cutter Restriction Sites

IDH1resmap.gif (5583 bytes)

 

Six-base cutter enzymes that do not cut:

AatII	AfeI	AgeI	ApaI	ApaLI	AseI	AvaI	AvrII	BamHI	BanII
BbeI	BclI	BfrBI	BglII	Bme1580I	BsaAI	BsaWI	BsiHKAI	BsiWI	Bsp1286I
BspEI	BsrFI	BsrGI	BssHII	BssSI	BstYI	BstZ17I	BtgI	BtrI	ClaI
DraI	EagI	Ecl136II	FspI	HindIII	HpaI	KasI	MluI	NaeI	NarI
NcoI	NdeI	NgoMIV	NheI	NruI	NsiI	PmlI	Ppu10I	PsiI	PspOMI
PstI	SacI	SacII	ScaI	SfcI	SfoI	SmaI	SnaBI	SpeI	SphI
SspI	StyI	TatI	XbaI	XhoI	XmaI	ZraI
RESTlegend.gif (2909 bytes)

 

 

 

Back