This web page was produced by Zack Perfect as an assignment for an undergraduate course at Davidson College

IDH2button.jpg (9894 bytes)

 

Nucleotide Sequence

1 ATGTTGAGAA ATACTTTTTT TAGAAACACC TCGAGGAGGT TTTTGGCTAC

51 TGTAAAGCAA CCTTCAATCG GAAGATATAC CGGCAAACCT AACCCTTCTA

101 CCGGCAAATA CACGGTCTCG TTCATTGAAG GTGATGGTAT CGGACCTGAA

151 ATTTCCAAGT CTGTAAAGAA AATCTTTAGT GCAGCAAACG TCCCCATAGA

201 ATGGGAATCT TGTGATGTTA GCCCTATCTT TGTCAACGGA TTAACGACCA

251 TTCCTGACCC TGCCGTACAA TCTATCACAA AAAACCTGGT TGCACTAAAA

301 GGTCCACTAG CTACACCTAT TGGTAAAGGT CACAGATCTT TGAATTTGAC

351 ATTGAGAAAA ACATTTGGGT TATTTGCCAA CGTTCGTCCC GCAAAGTCTA

401 TTGAAGGTTT TAAGACCACT TACGAAAACG TTGATTTAGT TCTTATCAGA

451 GAGAATACCG AAGGTGAATA TTCTGGTATC GAACACATAG TTTGCCCTGG

501 CGTTGTTCAA TCTATTAAAC TGATCACAAG AGATGCCTCT GAGCGAGTCA

551 TTAGATACGC TTTTGAATAT GCAAGAGCCA TCGGCAGACC AAGAGTTATT

601 GTGGTACATA AATCTACTAT CCAGAGATTA GCTGATGGTT TATTCGTTAA

651 TGTTGCCAAA GAACTATCCA AAGAGTATCC TGACCTTACT TTAGAAACTG

701 AACTTATTGA TAACAGTGTG TTAAAGGTGG TCACCAACCC ATCTGCTTAC

751 ACAGACGCTG TTTCTGTTTG TCCAAATCTA TACGGTGATA TCTTGTCCGA

801 CTTGAACTCT GGTTTGAGCG CCGGTTCTTT AGGTTTAACT CCATCTGCCA

851 ATATTGGTCA TAAAATCTCG ATCTTTGAAG CTGTCCATGG CTCTGCCCCT

901 GATATTGCCG GTCAAGATAA AGCGAATCCA ACTGCCCTAC TTTTATCTTC

951 AGTAATGATG TTAAACCACA TGGGTCTAAC GAATCATGCT GACCAAATTC

1001 AAAATGCAGT ATTGTCTACT ATCGCATCAG GTCCAGAAAA CAGAACAGGT

1051 GACTTGGCTG GTACTGCTAC TACTTCATCA TTCACTGAAG CAGTCATCAA

1101 GAGATTATAA

 

Amino Acid Sequence

1 MLRNTFFRNT SRRFLATVKQ PSIGRYTGKP NPSTGKYTVS FIEGDGIGPE

51 ISKSVKKIFS AANVPIEWES CDVSPIFVNG LTTIPDPAVQ SITKNLVALK

101 GPLATPIGKG HRSLNLTLRK TFGLFANVRP AKSIEGFKTT YENVDLVLIR

151 ENTEGEYSGI EHIVCPGVVQ SIKLITRDAS ERVIRYAFEY ARAIGRPRVI

201 VVHKSTIQRL ADGLFVNVAK ELSKEYPDLT LETELIDNSV LKVVTNPSAY

251 TDAVSVCPNL YGDILSDLNS GLSAGSLGLT PSANIGHKIS IFEAVHGSAP

301 DIAGQDKANP TALLLSSVMM LNHMGLTNHA DQIQNAVLST IASGPENRTG

351 DLAGTATTSS FTEAVIKRL

 

General protein information

 

Accession Number

14318439

 

Primers

5' ATGTTGAGAAATACTTTTTTTTAG 3' Tm = 45

5' TTATAATCTCTTGATGACTG 3' Tm = 44 C

 

Coenzyme

NAD+

 

In-frame Fusion Proteins of 6xHis

MRGS-HHHHHH-GSHVISSIVS-MLRNTFFRNTSRR

 

Six-cutter Restriction Sites

IDH2resmap.gif (3961 bytes)

 

Six-base cutter enzymes that do not cut:

AatII	Acc65I	AfeI	AflII	AflIII	AgeI	ApaI	ApaLI	AseI	AvrII
BamHI	BanI	BanII	BbeI	BfrBI	Bme1580I	BsaAI	BsaHI	BsaWI	BsiEI
BsiHKAI	BsiWI	Bsp1286I	BspEI	BspHI	BsrI	BsrBI	BsrGI	BssHII	BssSI
BstBI	BstZ17I	BtrI	Cac8I	ClaI	DraI	EaeI	EagI	Ecl136II	EcoRI
FspI	HindIII	HpaI	KasI	KpnI	MfeI	MluI	MscI	MspA1I	NaeI
NarI	NdeI	NgoMIV	NheI	NlaIV	NruI	NsiI	NspI	PciI	PmlI
Ppu10I	PspOMI	PstI	PvuI	PvuII	SacI	SacII	SalI	ScaI	SfcI
SfoI	SmaI	SnaBI	SpeI	SphI	StuI	TatI	XbaI	XmaI	ZraI
RESTlegend.gif (2909 bytes)

 

 

Back