This web page was produced by Zack Perfect as an assignment for an undergraduate course at Davidson College

IDP1button.jpg (9573 bytes)

 

Nucleotide Sequence

1 ATGAGTATGT TATCTAGAAG ATTATTTTCC ACCTCTCGCC TTGCTGCTTT

51 CAGTAAGATT AAGGTCAAAC AACCCGTTGT CGAGTTGGAC GGTGATGAAA

101 TGACCCGTAT CATTTGGGAT AAGATCAAGA AGAAATTGAT TCTACCCTAC

151 TTGGACGTAG ATTTGAAGTA CTACGACTTA TCTGTCGAAT CTCGTGACGC

201 CACCTCCGAC AAGATTACTC AGGATGCTGC TGAGGCGATC AAGAAGTATG

251 GTGTTGGTAT CAAATGTGCC ACCATCACTC CTGATGAAGC TCGTGTGAAG

301 GAATTCAACC TGCACAAGAT GTGGAAATCT CCTAATGGTA CCATCAGAAA

351 CATTCTCGGC GGTACAGTGT TCAGAGAGCC CATTGTGATT CCTAGAATTC

401 CTAGACTGGT CCCACGTTGG GAAAAACCAA TCATTATTGG AAGACACGCC

451 CACGGTGATC AATATAAAGC TACGGACACA CTGATCCCAG GCCCAGGATC

501 TTTGGAACTG GTCTACAAGC CATCCGACCC TACGACTGCT CAACCACAAA

551 CTTTGAAAGT GTATGACTAC AAGGGCAGTG GTGTGGCCAT GGCCATGTAC

601 AATACTGACG AATCCATCGA AGGGTTTGCT CATTCGTCTT TCAAGCTGGC

651 CATTGACAAA AAGCTAAATC TTTTCTTGTC AACCAAGAAC ACTATTTTGA

701 AGAAATATGA CGGTCGGTTC AAAGACATTT TCCAAGAAGT TTATGAAGCT

751 CAATATAAAT CCAAATTCGA ACAACTAGGG ATCCACTATG AACACCGTTT

801 AATTGATGAT ATGGTCGCTC AAATGATAAA ATCTAAAGGT GGCTTTATCA

851 TGGCGCTAAA GAACTATGAC GGTGATGTCC AATCTGACAT CGTCGCTCAA

901 GGATTTGGCT CCTTAGGTTT GATGACTTCT ATCTTAGTTA CACCAGACGG

951 TAAAACTTTC GAAAGTGAAG CTGCTCATGG TACCGTGACA AGACATTATA

1001 GAAAGTACCA AAAGGGTGAA GAAACTTCTA CAAACTCCAT TGCATCCATT

1051 TTCGCGTGGT CGAGAGGTCT ATTGAAGAGA GGTGAATTGG ACAATACTCC

1101 TGCTTTGTGT AAATTTGCCA ATATTTTGGA ATCCGCCACT TTGAACACAG

1151 TTCAGCAAGA CGGTATCATG ACGAAGGACT TGGCTTTGGC TTGCGGTAAC

1201 AACGAAAGAT CTGCTTATGT TACCACAGAA GAATTTTTGG ATGCCGTTGA

1251 AAAAAGACTA CAAAAAGAAA TCAAGTCGAT CGAGTAA

 

Amino Acid Sequence

1 MSMLSRRLFS TSRLAAFSKI KVKQPVVELD GDEMTRIIWD KIKKKLILPY

51 LDVDLKYYDL SVESRDATSD KITQDAAEAI KKYGVGIKCA TITPDEARVK

101 EFNLHKMWKS PNGTIRNILG GTVFREPIVI PRIPRLVPRW EKPIIIGRHA

151 HGDQYKATDT LIPGPGSLEL VYKPSDPTTA QPQTLKVYDY KGSGVAMAMY

201 NTDESIEGFA HSSFKLAIDK KLNLFLSTKN TILKKYDGRF KDIFQEVYEA

251 QYKSKFEQLG IHYEHRLIDD MVAQMIKSKG GFIMALKNYD GDVQSDIVAQ

01 GFGSLGLMTS ILVTPDGKTF ESEAAHGTVT RHYRKYQKGE ETSTNSIASI

351 FAWSRGLLKR GELDNTPALC KFANILESAT LNTVQQDGIM TKDLALACGN

401 NERSAYVTTE EFLDAVEKRL QKEIKSIE

 

General protein information

 

Accession Number

7839148

 

Primers

 

Forward: 5' ATGAGTATGTTATCTAGAAG 3' Tm = 44 C

Reverse: 5' TTACTCGATCGACTTGATTT 3' Tm = 46 C

 

Coenzyme

NADP+

 

In-frame Fusion Proteins of 6xHis

MRGS-HHHHHH-GSHVISSIVS-MSMLSRRLFSTSR

 

Six-cutter Restriction Sites

IDP1resmap.gif (6311 bytes)

Six-base cutter enzymes that do not cut:

AatII	AclI	AfeI	AflII	AflIII	AgeI	ApaI	ApaLI	AseI	AvaI
AvrII	BbeI	BfrBI	Bme1580I	BsaAI	BsaWI	BsiHKAI	BsiWI	BspEI	BsrBI
BsrFI	BssHII	BstZ17I	BtrI	ClaI	DraI	EagI	Ecl136II	EcoRV	FspI
HindIII	HpaI	KasI	MfeI	MluI	MspA1I	NaeI	NarI	NdeI	NgoMIV
NheI	NruI	NsiI	NspI	PciI	PmlI	Ppu10I	PsiI	PspOMI	PstI
PvuII	SacI	SacII	SalI	SfcI	SfoI	SmaI	SnaBI	SpeI	SphI
StuI	XhoI	XmaI	ZraI
RESTlegend.gif (2909 bytes)

 

 

 

 

Back