This web page was produced by Zack Perfect as an assignment for an undergraduate course at Davidson College

IDP2button.jpg (10025 bytes)

 

Nucleotide Sequence

1 ATGACAAAGA TTAAGGTAGC TAACCCCATT GTGGAAATGG ACGGCGATGA

51 GCAAACAAGA ATAATCTGGC ATTTAATCAG GGACAAGTTA GTCTTGCCCT

101 ATCTTGACGT TGATTTGAAG TACTACGATC TTTCCGTGGA GTATCGTGAC

151 CAGACTAATG ATCAAGTAAC TGTGGATTCT GCCACCGCGA CTTTAAAGTA

201 TGGAGTAGCT GTCAAATGCG CGACTATTAC ACCCGATGAG GCAAGGGTCG

251 AGGAATTTCA TTTGAAAAAG ATGTGGAAAT CTCCAAATGG TACTATTAGA

301 AACATTTTGG GTGGTACAGT GTTCAGAGAA CCTATTATTA TCCCTAGAAT

351 TCCAAGGCTA GTTCCTCAAT GGGAGAAGCC CATCATCATT GGGAGACACG

401 CATTCGGCGA TCAGTACAAA GCTACCGATG TAATAGTCCC TGAAGAAGGC

451 GAGTTGAGGC TTGTTTATAA ATCCAAGAGC GGAACTCATG ATGTAGATCT

501 GAAGGTATTT GACTACCCAG AACATGGTGG GGTTGCCATG ATGATGTACA

551 ACACTACAGA TTCGATCGAA GGGTTTGCGA AGGCCTCCTT TGAATTGGCC

601 ATTGAAAGGA AGTTACCATT ATATTCCACT ACTAAGAATA CTATTTTGAA

651 GAAGTATGAT GGTAAATTCA AAGATGTTTT CGAAGCCATG TATGCTAGAA

701 GTTATAAAGA GAAGTTTGAA TCCCTTGGCA TCTGGTACGA GCACCGTTTA

751 ATTGATGATA TGGTGGCCCA AATGTTGAAA TCTAAAGGTG GATACATAAT

801 TGCCATGAAA AATTACGACG GTGACGTAGA ATCAGATATT GTTGCACAAG

851 GATTTGGCTC CTTGGGGTTA ATGACATCTG TGTTGATTAC CCCGGACGGT

901 AAAACCTTTG AAAGCGAAGC CGCCCACGGT ACAGTAACAA GACATTTTAG

951 ACAGCATCAG CAAGGAAAGG AGACGTCAAC AAATTCCATT GCATCAATTT

1001 TCGCGTGGAC TAGAGGTATT ATTCAAAGGG GTAAACTTGA TAATACTCCA

1051 GATGTAGTTA AGTTCGGCCA AATATTGGAA AGCGCTACGG TAAATACAGT

1101 GCAAGAAGAT GGAATCATGA CTAAAGATTT GGCGCTCATT CTCGGTAAGT

1151 CTGAAAGATC CGCTTATGTC ACTACCGAGG AGTTCATTGA CGCGGTGGAA

1201 TCTAGATTGA AAAAAGAGTT CGAGGCAGCT GCATTGTAA

 

Amino Acid Sequence

1 MTKIKVANPI VEMDGDEQTR IIWHLIRDKL VLPYLDVDLK YYDLSVEYRD

51 QTNDQVTVDS ATATLKYGVA VKCATITPDE ARVEEFHLKK MWKSPNGTIR

101 NILGGTVFRE PIIIPRIPRL VPQWEKPIII GRHAFGDQYK ATDVIVPEEG

151 ELRLVYKSKS GTHDVDLKVF DYPEHGGVAM MMYNTTDSIE GFAKASFELA

201 IERKLPLYST TKNTILKKYD GKFKDVFEAM YARSYKEKFE SLGIWYEHRL

251 IDDMVAQMLK SKGGYIIAMK NYDGDVESDI VAQGFGSLGL MTSVLITPDG

301 KTFESEAAHG TVTRHFRQHQ QGKETSTNSI ASIFAWTRGI IQRGKLDNTP

351 DVVKFGQILE SATVNTVQED GIMTKDLALI LGKSERSAYV TTEEFIDAVE

401 SRLKKEFEAA AL

 

General Protein Information

 

Accession Number

14389432

 

Primers

 

Forward: 5' ATGACAAAGATTAAGGTAGC 3' Tm = 46 C

Reverse: 5' TTACAATGCAGCTGCCTCGA 3' Tm = 52 C

 

Coenzyme

NADP+

 

In-frame Fusion Proteins of 6xHis

MRGS-HHHHHH-GSHVISSIVS-MTKIKVANPIVEM

 

Six-cutter Restriction Sites

IDP2resmap.gif (6213 bytes)

Six-base cutter enzymes that do not cut:

AccI	Acc65I	AclI	AflII	AflIII	AgeI	ApaI	ApaLI	AseI	AvaI
AvrII	BamHI	BanI	BanII	BbeI	BfrBI	Bme1580I	BsaAI	BsaWI	BsiWI
BspEI	BsrI	BsrFI	BssHII	BssSI	BstZ17I	BtrI	Cac8I	ClaI	EagI
Ecl136II	EcoRV	FspI	HindIII	HpaI	KasI	KpnI	MfeI	MluI	NaeI
NarI	NcoI	NdeI	NgoMIV	NheI	NruI	NsiI	NspI	PciI	PmlI
Ppu10I	PspOMI	PstI	SacI	SacII	SalI	SfoI	SmaI	SmlI	SnaBI
SpeI	SphI	XhoI	XmaI
RESTlegend.gif (2909 bytes)

 

 

 

Back