This web page was produced by Zack Perfect as an assignment for an undergraduate course at Davidson College

IDP3button.jpg (10180 bytes)

 

Nucleotide Sequence

1 ATGAGTAAAA TTAAAGTTGT TCATCCCATC GTGGAAATGG ACGGTGATGA

51 GCAGACAAGA GTTATTTGGA AACTTATCAA AGAAAAATTG ATATTGCCAT

101 ATTTAGATGT GGATTTAAAA TACTATGACC TTTCAATCCA AGAGCGTGAT

151 AGGACTAATG ATCAAGTAAC AAAGGATTCT TCTTATGCTA CCCTAAAATA

201 TGGGGTTGCT GTCAAATGTG CCACTATAAC ACCCGATGAG GCAAGAATGA

251 AAGAATTTAA CCTTAAAGAA ATGTGGAAAT CTCCAAATGG AACAATCAGA

301 AACATCCTAG GTGGAACTGT ATTTAGAGAA CCCATCATTA TTCCAAAAAT

351 ACCTCGTCTA GTCCCTCACT GGGAGAAACC TATAATTATA GGCCGTCATG

401 CTTTTGGTGA CCAATATAGG GCTACTGACA TCAAGATTAA AAAAGCAGGC

451 AAACTAAGGT TACAGTTTAG CTCAGATGAC GGTAAAGAAA ACATCGATTT

501 AAAGGTTTAT GAATTTCCTA AAAGTGGTGG GATCGCAATG GCAATGTTTA

551 ATACAAATGA TTCCATTAAA GGGTTCGCAA AGGCATCCTT CGAATTAGCT

601 CTCAAAAGAA AACTACCGTT ATTCTTTACA ACCAAAAACA CTATTCTGAA

651 AAATTATGAT AATCAGTTCA AACAAATTTT CGATAATTTG TTCGATAAAG

701 AATATAAGGA AAAGTTTCAG GCTTTAAAAA TAACGTACGA GCATCGTTTG

751 ATTGATGATA TGGTAGCACA GATGCTAAAA TCAAAGGGCG GGTTTATAAT

801 CGCCATGAAG AATTATGATG GCGATGTCCA GTCTGACATT GTGGCACAAG

851 GATTTGGGTC TCTTGGTTTA ATGACGTCCA TATTGATTAC ACCTGATGGT

901 AAAACGTTTG AAAGCGAGGC TGCCCATGGT ACGGTGACCA GACATTTTAG

951 AAAACATCAA AGAGGCGAAG AAACATCAAC AAATTCAATA GCCTCAATAT

1001 TTGCCTGGAC AAGGGCAATT ATACAAAGAG GAAAATTAGA CAATACAGAT

1051 GATGTTATAA AATTTGGAAA CTTACTAGAA AAGGCTACTT TGGACACAGT

1101 TCAAGTGGGC GGAAAAATGA CCAAGGATTT AGCATTGATG CTTGGAAAGA

1151 CTAATAGATC ATCATATGTA ACCACAGAAG AGTTTATTGA TGAAGTTGCC

1201 AAGAGGCTTC AAAACATGAT GCTCAGCTCC AATGAAGACA AGAAAGGTAT

1251 GTGCAAACTA TAA

 

Amino Acid Sequence

1 MSKIKVVHPI VEMDGDEQTR VIWKLIKEKL ILPYLDVDLK YYDLSIQERD

51 RTNDQVTKDS SYATLKYGVA VKCATITPDE ARMKEFNLKE MWKSPNGTIR

101 NILGGTVFRE PIIIPKIPRL VPHWEKPIII GRHAFGDQYR ATDIKIKKAG

151 KLRLQFSSDD GKENIDLKVY EFPKSGGIAM AMFNTNDSIK GFAKASFELA

201 LKRKLPLFFT TKNTILKNYD NQFKQIFDNL FDKEYKEKFQ ALKITYEHRL

251 IDDMVAQMLK SKGGFIIAMK NYDGDVQSDI VAQGFGSLGL MTSILITPDG

301 KTFESEAAHG TVTRHFRKHQ RGEETSTNSI ASIFAWTRAI IQRGKLDNTD

351 DVIKFGNLLE KATLDTVQVG GKMTKDLALM LGKTNRSSYV TTEEFIDEVA

401 KRLQNMMLSS NEDKKGMCKL

 

General Protein Information

 

Accession Number

6323989

 

Primers

 

Forward: 5' ATGAGTAAAATTAAAGTTGTTCAT 3' Tm = 45 C

Reverse: 5' TTATAGTTTGCACATACCTT 3' Tm = 44 C

 

Coenzyme

NADP+

 

In-frame Fusion Proteins of 6xHis

MRGS-HHHHHH-GSHVISSIVS-MSKIKVVHPIVEM

 

Six-cutter Restriction Sites

IDP3resmap.gif (3878 bytes)

Six-base cutter enzymes that do not cut:

AccI	Acc65I	AfeI	AflII	AflIII	AgeI	ApaI	ApaLI	AseI	AvaI
BamHI	BanI	BanII	BbeI	BfrBI	BglII	Bme1580I	BsaAI	BsaWI	BsiEI
BsiHKAI	Bsp1286I	BspEI	BspHI	BsrBI	BsrFI	BsrGI	BssHII	BssSI	BstYI
BstZ17I	BtrI	EaeI	EagI	Ecl136II	EcoRI	EcoRV	FspI	HaeII	HincII
HindIII	HpaI	Hpy8I	KasI	KpnI	MfeI	MluI	MscI	MspA1I	NaeI
NarI	NgoMIV	NheI	NlaIV	NruI	NsiI	NspI	PciI	PmlI	Ppu10I
PspOMI	PstI	PvuI	PvuII	SacI	SacII	SalI	ScaI	SfcI	SfoI
SmaI	SmlI	SnaBI	SpeI	SphI	StuI	TatI	XbaI	XhoI	XmaI
RESTlegend.gif (2909 bytes)

 

 

 

Back