This page was created as an assignment for an undergraduate course at Davidson College.

Previous Page

Primers used to clone the 5 isocitrate dehydrogenase genes

Ideally all primers should have the following characteristics: (Campbell, 2002)

1. A length between 18-30 nucleotides

2. A Tm between 44-46 Celsius

Melting Temperatures calculated at this site:

http://members.aol.com/_ht_a/lucatoldo/myhomepage/JaMBW/3/1/9/index.html

3. At GC content between 40-60%

Reverse complement of gene for reverse primers was obtained at this site:

http://www.ualberta.ca/~stothard/javascript/rev_comp.html

IDH1

Forward Primer

5 ATGCTTAACAGAACAATTGC 3

Length = 20

Tm = 46°C

GC% = 35%

Reverse Primer

5 TTACATGGTAGATAATTTGTTG 3

Length = 22

Tm = 46°C

GC% = 27%


IDH2

Forward Primer

5 ATGTTGAGAAATACTTTTTTTAG 3

Length = 23

Tm = 45°C

GC% = 22%

Reverse Primer

5 TTATAATCTCTTGATGACTG 3

Length = 20

Tm = 44°C

GC% = 30%


IDP1

Forward Primer

5 ATGAGTATGTTATCTAGAAG 3

Length = 20

Tm = 44°C

GC% = 30%

Reverse Primer

5 TTACTCGATCGACTTGATTT 3

Length = 20

Tm = 46°C

GC = 35%


IDP2

Forward Primer

5 ATGACAAAGATTAAGGTAGC 3

Length = 20

Tm = 46°C

GC% = 35%

Reverse Primer

5 TTACAATGCAGCTGCCTCGA 3

Length = 20

Tm = 52°C

GC = 50%


IDP3

Forward Primer

5 ATGAGTAAAATTAAAGTTGTTCAT 3

Length = 24

Tm = 45°C

GC% = 21%

Reverse Primer

5 TTATAGTTTGCACATACCTT 3

Length = 20

Tm = 44°C

GC% = 30%

Previous Page