*This page is part of undergraduate assignment for Molecular Biology at Davidson College

 

 

Cloning 5 Isoforms of Isocitrate Dehydrogenase

---

 

IDH1: 
Genebank Accession Number: NC_001146

 

DNA Sequence

Amino Acid Sequence

Genome Restriction Map

PCR Primers

In Frame Fusion Protein

Coenzyme

 

Gene Sequence (DNA with introns):

1 ATGCTTAACA GAACAATTGC TAAGAGAACT TTAGCCACTG CCGCTCAGGC 
51 GGAACGCACC CTACCCAAGA AGTATGGCGG TCGTTTCACC GTCACTTTGA 
101 TACCTGGTGA CGGTGTTGGG AAAGAAATCA CTGATTCAGT GAGAACCATT 
151 TTTGAGGCTG AAAATATCCC GATCGACTGG GAAACTATAA ACATTAAGCA 
201 AACAGATCAT AAGGAAGGCG TCTATGAAGC TGTTGAGTCT CTAAAGAGAA 
251 ATAAGATTGG TCTTAAGGGG CTATGGCACA CTCCTGCTGA CCAAACAGGT 
301 CACGGTTCAC TAAACGTTGC TTTGCGTAAA CAACTAGATA TCTACGCCAA 
351 TGTGGCCCTT TTCAAATCCT TGAAGGGTGT CAAGACTAGA ATTCCAGACA 
401 TAGATTTGAT TGTCATTAGA GAAAACACGG AGGGTGAGTT CTCAGGCCTG 
451 GAACATGAAT CCGTCCCTGG TGTAGTGGAA TCTTTGAAAG TTATGACTAG 
501 ACCTAAGACA GAAAGGATCG CCAGATTTGC CTTTGACTTC GCCAAGAAAT 
551 ACAACAGAAA GTCTGTCACA GCTGTGCATA AGGCAAATAT CATGAAGTTA 
601 GGTGACGGTC TGTTCAGAAA TATAATAACT GAAATTGGCC AAAAAGAATA 
651 TCCTGATATT GACGTATCGT CCATCATTGT CGACAATGCC TCCATGCAGG 
701 CGGTGGCCAA ACCTCATCAA TTTGATGTCC TAGTTACCCC TTCAATGTAC 
751 GGTACCATCT TAGGCAACAT TGGCGCTGCT TTGATCGGTG GTCCAGGATT 
801 GGTGGCAGGT GCCAACTTTG GCAGGGACTA TGCTGTCTTC GAACCAGGTT 
851 CCAGACATGT TGGTTTAGAT ATTAAAGGCC AAAATGTGGC TAACCCAACT 
901 GCCATGATCC TTTCCTCCAC GTTAATGTTG AACCATTTGG GTTTGAATGA 
951 ATATGCTACT AGAATCTCAA AGGCAGTTCA TGAAACGATC GCAGAAGGTA 
1001 AGCATACCAC TAGAGATATT GGTGGTTCCT CTTCTACTAC TGACTTCACG 
1051               AATGAAATCA TCAACAAATT ATCTACCATG TAA
(SGD, 1997)

 

Amino Acid Sequence:

1 MLNRTIAKRT LATAAQAERT LPKKYGGRFT VTLIPGDGVG KEITDSVRTI 
51 FEAENIPIDW ETINIKQTDH KEGVYEAVES LKRNKIGLKG LWHTPADQTG 
101 HGSLNVALRK QLDIYANVAL FKSLKGVKTR IPDIDLIVIR ENTEGEFSGL 
151 EHESVPGVVE SLKVMTRPKT ERIARFAFDF AKKYNRKSVT AVHKANIMKL 
201 GDGLFRNIIT EIGQKEYPDI DVSSIIVDNA SMQAVAKPHQ FDVLVTPSMY 
251 GTILGNIGAA LIGGPGLVAG ANFGRDYAVF EPGSRHVGLD IKGQNVANPT 
301 AMILSSTLML NHLGLNEYAT RISKAVHETI AEGKHTTRDI GGSSSTTDFT 
351 NEIINKLSTM 
(SGD, 1997)

 

Genome Restriction Map for IDH1:

PCR primers for IDH1:

Forward: 5' ATGCTTAACAGAACAATTGC 3' Tm = 46 C

Reverse: 5' TTACATGGTAGATAATTTGTTG 3' Tm = 46 C

In Frame Fusion Protein:

HIS HIS HIS HIS HIS HIS MLNRTIAKRT

Coenzyme for IDH1:

NAD+

 

Reference Page


Isocitrate Dehydrogenase Main Page

Molecular Biology Main Page

Course Materials

Biology Main Page

College Home Pagesearch


Created by: Elizabeth Shafer. Email questions to lishafer@davidson.edu