*This page is part of undergraduate assignment for Molecular Biology at Davidson College

 

 

Cloning 5 Isoforms of Isocitrate Dehydrogenase

---

IDH2

Genebank Accession Number: NC_001147

 

DNA Sequence

Amino Acid Sequence

Genome Restriction Map

PCR Primers

In Frame Fusion Protein

Coenzyme

Gene Sequence (with introns):

1 ATGTTGAGAA ATACTTTTTT TAGAAACACC TCGAGGAGGT TTTTGGCTAC 
51 TGTAAAGCAA CCTTCAATCG GAAGATATAC CGGCAAACCT AACCCTTCTA 
101 CCGGCAAATA CACGGTCTCG TTCATTGAAG GTGATGGTAT CGGACCTGAA 
151 ATTTCCAAGT CTGTAAAGAA AATCTTTAGT GCAGCAAACG TCCCCATAGA 
201 ATGGGAATCT TGTGATGTTA GCCCTATCTT TGTCAACGGA TTAACGACCA 
251 TTCCTGACCC TGCCGTACAA TCTATCACAA AAAACCTGGT TGCACTAAAA 
301 GGTCCACTAG CTACACCTAT TGGTAAAGGT CACAGATCTT TGAATTTGAC 
351 ATTGAGAAAA ACATTTGGGT TATTTGCCAA CGTTCGTCCC GCAAAGTCTA 
401 TTGAAGGTTT TAAGACCACT TACGAAAACG TTGATTTAGT TCTTATCAGA 
451 GAGAATACCG AAGGTGAATA TTCTGGTATC GAACACATAG TTTGCCCTGG 
501 CGTTGTTCAA TCTATTAAAC TGATCACAAG AGATGCCTCT GAGCGAGTCA 
551 TTAGATACGC TTTTGAATAT GCAAGAGCCA TCGGCAGACC AAGAGTTATT 
601 GTGGTACATA AATCTACTAT CCAGAGATTA GCTGATGGTT TATTCGTTAA 
651 TGTTGCCAAA GAACTATCCA AAGAGTATCC TGACCTTACT TTAGAAACTG 
701 AACTTATTGA TAACAGTGTG TTAAAGGTGG TCACCAACCC ATCTGCTTAC 
751 ACAGACGCTG TTTCTGTTTG TCCAAATCTA TACGGTGATA TCTTGTCCGA 
801 CTTGAACTCT GGTTTGAGCG CCGGTTCTTT AGGTTTAACT CCATCTGCCA 
851 ATATTGGTCA TAAAATCTCG ATCTTTGAAG CTGTCCATGG CTCTGCCCCT 
901 GATATTGCCG GTCAAGATAA AGCGAATCCA ACTGCCCTAC TTTTATCTTC 
951 AGTAATGATG TTAAACCACA TGGGTCTAAC GAATCATGCT GACCAAATTC 
1001 AAAATGCAGT ATTGTCTACT ATCGCATCAG GTCCAGAAAA CAGAACAGGT 
1051 GACTTGGCTG GTACTGCTAC TACTTCATCA TTCACTGAAG CAGTCATCAA 
1101 GAGATTATAA 
(SGD 1997)
 
Amino Acid Sequence:
 
1 MLRNTFFRNT SRRFLATVKQ PSIGRYTGKP NPSTGKYTVS FIEGDGIGPE 
51 ISKSVKKIFS AANVPIEWES CDVSPIFVNG LTTIPDPAVQ SITKNLVALK 
101 GPLATPIGKG HRSLNLTLRK TFGLFANVRP AKSIEGFKTT YENVDLVLIR 
151 ENTEGEYSGI EHIVCPGVVQ SIKLITRDAS ERVIRYAFEY ARAIGRPRVI 
201 VVHKSTIQRL ADGLFVNVAK ELSKEYPDLT LETELIDNSV LKVVTNPSAY 
251 TDAVSVCPNL YGDILSDLNS GLSAGSLGLT PSANIGHKIS IFEAVHGSAP 
301 DIAGQDKANP TALLLSSVMM LNHMGLTNHA DQIQNAVLST IASGPENRTG 
351 DLAGTATTSS FTEAVIKRL
(SGD 1997)
 
Gene Restriction Fragment Map of IDH2:
 
IDH2 PCR Primers:

Forward: 5' ATGTTGAGAAATACTTTTTTTTAG 3' Tm = 45 C

Reverse: 5' TTATAATCTCTTGATGACTG 3' Tm = 44 C

In Frame Fusion Protein:
HIS HIS HIS HIS HIS HIS MLRNTFFRNT
 
IDH2 Coenzyme:
NAD+
 

Reference Page


Isocitrate Dehydrogenase Main Page

Molecular Biology Main Page

Course Materials

Biology Main Page

College Home Pagesearch


Created by: Elizabeth Shafer. Email questions to lishafer@davidson.edu