*This page is part of undergraduate assignment for Molecular Biology at Davidson College

 

 

Cloning 5 Isoforms of Isocitrate Dehydrogenase

---

IDP1

Genebank Accession Number: NC_001136

 

DNA Sequence
Amino Acid Sequence

Genome Restriction Map

PCR Primers

In Frame Fusion Protein

Coenzyme

Gene Sequence (with introns):

1 ATGAGTATGT TATCTAGAAG ATTATTTTCC ACCTCTCGCC TTGCTGCTTT 
51 CAGTAAGATT AAGGTCAAAC AACCCGTTGT CGAGTTGGAC GGTGATGAAA 
101 TGACCCGTAT CATTTGGGAT AAGATCAAGA AGAAATTGAT TCTACCCTAC 
151 TTGGACGTAG ATTTGAAGTA CTACGACTTA TCTGTCGAAT CTCGTGACGC 
201 CACCTCCGAC AAGATTACTC AGGATGCTGC TGAGGCGATC AAGAAGTATG 
251 GTGTTGGTAT CAAATGTGCC ACCATCACTC CTGATGAAGC TCGTGTGAAG 
301 GAATTCAACC TGCACAAGAT GTGGAAATCT CCTAATGGTA CCATCAGAAA 
351 CATTCTCGGC GGTACAGTGT TCAGAGAGCC CATTGTGATT CCTAGAATTC 
401 CTAGACTGGT CCCACGTTGG GAAAAACCAA TCATTATTGG AAGACACGCC 
451 CACGGTGATC AATATAAAGC TACGGACACA CTGATCCCAG GCCCAGGATC 
501 TTTGGAACTG GTCTACAAGC CATCCGACCC TACGACTGCT CAACCACAAA 
551 CTTTGAAAGT GTATGACTAC AAGGGCAGTG GTGTGGCCAT GGCCATGTAC 
601 AATACTGACG AATCCATCGA AGGGTTTGCT CATTCGTCTT TCAAGCTGGC 
651 CATTGACAAA AAGCTAAATC TTTTCTTGTC AACCAAGAAC ACTATTTTGA 
701 AGAAATATGA CGGTCGGTTC AAAGACATTT TCCAAGAAGT TTATGAAGCT 
751 CAATATAAAT CCAAATTCGA ACAACTAGGG ATCCACTATG AACACCGTTT 
801 AATTGATGAT ATGGTCGCTC AAATGATAAA ATCTAAAGGT GGCTTTATCA 
851 TGGCGCTAAA GAACTATGAC GGTGATGTCC AATCTGACAT CGTCGCTCAA 
901 GGATTTGGCT CCTTAGGTTT GATGACTTCT ATCTTAGTTA CACCAGACGG 
951 TAAAACTTTC GAAAGTGAAG CTGCTCATGG TACCGTGACA AGACATTATA 
1001 GAAAGTACCA AAAGGGTGAA GAAACTTCTA CAAACTCCAT TGCATCCATT 
1051 TTCGCGTGGT CGAGAGGTCT ATTGAAGAGA GGTGAATTGG ACAATACTCC 
1101 TGCTTTGTGT AAATTTGCCA ATATTTTGGA ATCCGCCACT TTGAACACAG 
1151 TTCAGCAAGA CGGTATCATG ACGAAGGACT TGGCTTTGGC TTGCGGTAAC 
1201 AACGAAAGAT CTGCTTATGT TACCACAGAA GAATTTTTGG ATGCCGTTGA 
1251 AAAAAGACTA CAAAAAGAAA TCAAGTCGAT CGAGTAA
(SGD 1997) 
 

Amino Acid Sequence:

1 MSMLSRRLFS TSRLAAFSKI KVKQPVVELD GDEMTRIIWD KIKKKLILPY 
51 LDVDLKYYDL SVESRDATSD KITQDAAEAI KKYGVGIKCA TITPDEARVK 
101 EFNLHKMWKS PNGTIRNILG GTVFREPIVI PRIPRLVPRW EKPIIIGRHA 
151 HGDQYKATDT LIPGPGSLEL VYKPSDPTTA QPQTLKVYDY KGSGVAMAMY 
201 NTDESIEGFA HSSFKLAIDK KLNLFLSTKN TILKKYDGRF KDIFQEVYEA 
251 QYKSKFEQLG IHYEHRLIDD MVAQMIKSKG GFIMALKNYD GDVQSDIVAQ 
301 GFGSLGLMTS ILVTPDGKTF ESEAAHGTVT RHYRKYQKGE ETSTNSIASI 
351 FAWSRGLLKR GELDNTPALC KFANILESAT LNTVQQDGIM TKDLALACGN 
401 NERSAYVTTE EFLDAVEKRL QKEIKSIE

(SGD 1997)

 

Gene Restriction Fragment Map of IDP1:

 

IDP1 PCR Primers:

Forward: 5' ATGAGTATGTTATCTAGAAG 3' Tm = 44 C

Reverse: 5' TTACTCGATCGACTTGATTT 3' Tm = 46 C

In Frame Fusion Protein:

HIS HIS HIS HIS HIS HIS MSMLSRRLFS

 

IDP1 Coenzyme:

NADP+

 

Reference Page


Isocitrate Dehydrogenase Main Page

Molecular Biology Main Page

Course Materials

Biology Main Page

College Home Pagesearch


Created by: Elizabeth Shafer. Email questions to lishafer@davidson.edu