*This page is part of undergraduate assignment for Molecular Biology at Davidson College

 

 

Cloning 5 Isoforms of Isocitrate Dehydrogenase

---

IDP2

Genebank Accession Number: NC_001144

 

DNA Sequence
Amino Acid Sequence

Genome Restriction Map

PCR Primers

In Frame Fusion Protein

Coenzyme

Gene Sequence (with introns): 
1 ATGACAAAGA TTAAGGTAGC TAACCCCATT GTGGAAATGG ACGGCGATGA 
51 GCAAACAAGA ATAATCTGGC ATTTAATCAG GGACAAGTTA GTCTTGCCCT 
101 ATCTTGACGT TGATTTGAAG TACTACGATC TTTCCGTGGA GTATCGTGAC 
151 CAGACTAATG ATCAAGTAAC TGTGGATTCT GCCACCGCGA CTTTAAAGTA 
201 TGGAGTAGCT GTCAAATGCG CGACTATTAC ACCCGATGAG GCAAGGGTCG 
251 AGGAATTTCA TTTGAAAAAG ATGTGGAAAT CTCCAAATGG TACTATTAGA 
301 AACATTTTGG GTGGTACAGT GTTCAGAGAA CCTATTATTA TCCCTAGAAT 
351 TCCAAGGCTA GTTCCTCAAT GGGAGAAGCC CATCATCATT GGGAGACACG 
401 CATTCGGCGA TCAGTACAAA GCTACCGATG TAATAGTCCC TGAAGAAGGC 
451 GAGTTGAGGC TTGTTTATAA ATCCAAGAGC GGAACTCATG ATGTAGATCT 
501 GAAGGTATTT GACTACCCAG AACATGGTGG GGTTGCCATG ATGATGTACA 
551 ACACTACAGA TTCGATCGAA GGGTTTGCGA AGGCCTCCTT TGAATTGGCC 
601 ATTGAAAGGA AGTTACCATT ATATTCCACT ACTAAGAATA CTATTTTGAA 
651 GAAGTATGAT GGTAAATTCA AAGATGTTTT CGAAGCCATG TATGCTAGAA 
701 GTTATAAAGA GAAGTTTGAA TCCCTTGGCA TCTGGTACGA GCACCGTTTA 
751 ATTGATGATA TGGTGGCCCA AATGTTGAAA TCTAAAGGTG GATACATAAT 
801 TGCCATGAAA AATTACGACG GTGACGTAGA ATCAGATATT GTTGCACAAG 
851 GATTTGGCTC CTTGGGGTTA ATGACATCTG TGTTGATTAC CCCGGACGGT 
901 AAAACCTTTG AAAGCGAAGC CGCCCACGGT ACAGTAACAA GACATTTTAG 
951 ACAGCATCAG CAAGGAAAGG AGACGTCAAC AAATTCCATT GCATCAATTT 
1001 TCGCGTGGAC TAGAGGTATT ATTCAAAGGG GTAAACTTGA TAATACTCCA 
1051 GATGTAGTTA AGTTCGGCCA AATATTGGAA AGCGCTACGG TAAATACAGT 
1101 GCAAGAAGAT GGAATCATGA CTAAAGATTT GGCGCTCATT CTCGGTAAGT 
1151 CTGAAAGATC CGCTTATGTC ACTACCGAGG AGTTCATTGA CGCGGTGGAA 
1201 TCTAGATTGA AAAAAGAGTT CGAGGCAGCT GCATTGTAA

(SGD 1997)

Amino Acid Sequence:

1 MTKIKVANPI VEMDGDEQTR IIWHLIRDKL VLPYLDVDLK YYDLSVEYRD 
51 QTNDQVTVDS ATATLKYGVA VKCATITPDE ARVEEFHLKK MWKSPNGTIR 
101 NILGGTVFRE PIIIPRIPRL VPQWEKPIII GRHAFGDQYK ATDVIVPEEG 
151 ELRLVYKSKS GTHDVDLKVF DYPEHGGVAM MMYNTTDSIE GFAKASFELA 
201 IERKLPLYST TKNTILKKYD GKFKDVFEAM YARSYKEKFE SLGIWYEHRL 
251 IDDMVAQMLK SKGGYIIAMK NYDGDVESDI VAQGFGSLGL MTSVLITPDG 
301 KTFESEAAHG TVTRHFRQHQ QGKETSTNSI ASIFAWTRGI IQRGKLDNTP 
351 DVVKFGQILE SATVNTVQED GIMTKDLALI LGKSERSAYV TTEEFIDAVE 
401 SRLKKEFEAA AL
(SGD 1997)

Gene Restriction Fragment Map:

IDP2 PCR Primers:

Forward: 5' ATGACAAAGATTAAGGTAGC 3' Tm = 46 C

Reverse: 5' TTACAATGCAGCTGCCTCGA 3' Tm = 52 C

In Frame Fusion Protein:

HIS HIS HIS HIS HIS HIS MTKIKVANPI

 

IDP2 Coenzyme:

NADP+

Reference Page


Isocitrate Dehydrogenase Main Page

Molecular Biology Main Page

Course Materials

Biology Main Page

College Home Pagesearch


Created by: Elizabeth Shafer. Email questions to lishafer@davidson.edu