*This page is part of undergraduate assignment for Molecular Biology at Davidson College

 

 

Cloning 5 Isoforms of Isocitrate Dehydrogenase

---

IDP3

Genebank Accession Number: NC_001146

 

DNA Sequence
Amino Acid Sequence

Genome Restriction Map

PCR Primers

In Frame Fusion Protein

Coenzyme

Gene Sequence (with introns):

1 ATGAGTAAAA TTAAAGTTGT TCATCCCATC GTGGAAATGG ACGGTGATGA 
51 GCAGACAAGA GTTATTTGGA AACTTATCAA AGAAAAATTG ATATTGCCAT 
101 ATTTAGATGT GGATTTAAAA TACTATGACC TTTCAATCCA AGAGCGTGAT 
151 AGGACTAATG ATCAAGTAAC AAAGGATTCT TCTTATGCTA CCCTAAAATA 
201 TGGGGTTGCT GTCAAATGTG CCACTATAAC ACCCGATGAG GCAAGAATGA 
251 AAGAATTTAA CCTTAAAGAA ATGTGGAAAT CTCCAAATGG AACAATCAGA 
301 AACATCCTAG GTGGAACTGT ATTTAGAGAA CCCATCATTA TTCCAAAAAT 
351 ACCTCGTCTA GTCCCTCACT GGGAGAAACC TATAATTATA GGCCGTCATG 
401 CTTTTGGTGA CCAATATAGG GCTACTGACA TCAAGATTAA AAAAGCAGGC 
451 AAACTAAGGT TACAGTTTAG CTCAGATGAC GGTAAAGAAA ACATCGATTT 
501 AAAGGTTTAT GAATTTCCTA AAAGTGGTGG GATCGCAATG GCAATGTTTA 
551 ATACAAATGA TTCCATTAAA GGGTTCGCAA AGGCATCCTT CGAATTAGCT 
601 CTCAAAAGAA AACTACCGTT ATTCTTTACA ACCAAAAACA CTATTCTGAA 
651 AAATTATGAT AATCAGTTCA AACAAATTTT CGATAATTTG TTCGATAAAG 
701 AATATAAGGA AAAGTTTCAG GCTTTAAAAA TAACGTACGA GCATCGTTTG 
751 ATTGATGATA TGGTAGCACA GATGCTAAAA TCAAAGGGCG GGTTTATAAT 
801 CGCCATGAAG AATTATGATG GCGATGTCCA GTCTGACATT GTGGCACAAG 
851 GATTTGGGTC TCTTGGTTTA ATGACGTCCA TATTGATTAC ACCTGATGGT 
901 AAAACGTTTG AAAGCGAGGC TGCCCATGGT ACGGTGACCA GACATTTTAG 
951 AAAACATCAA AGAGGCGAAG AAACATCAAC AAATTCAATA GCCTCAATAT 
1001 TTGCCTGGAC AAGGGCAATT ATACAAAGAG GAAAATTAGA CAATACAGAT 
1051 GATGTTATAA AATTTGGAAA CTTACTAGAA AAGGCTACTT TGGACACAGT 
1101 TCAAGTGGGC GGAAAAATGA CCAAGGATTT AGCATTGATG CTTGGAAAGA 
1151 CTAATAGATC ATCATATGTA ACCACAGAAG AGTTTATTGA TGAAGTTGCC 
1201 AAGAGGCTTC AAAACATGAT GCTCAGCTCC AATGAAGACA AGAAAGGTAT 
1251 GTGCAAACTA TAA
(SGD 1997)

Amino Acid Sequence:

1 MSKIKVVHPI VEMDGDEQTR VIWKLIKEKL ILPYLDVDLK YYDLSIQERD 
51 RTNDQVTKDS SYATLKYGVA VKCATITPDE ARMKEFNLKE MWKSPNGTIR 
101 NILGGTVFRE PIIIPKIPRL VPHWEKPIII GRHAFGDQYR ATDIKIKKAG 
151 KLRLQFSSDD GKENIDLKVY EFPKSGGIAM AMFNTNDSIK GFAKASFELA 
201 LKRKLPLFFT TKNTILKNYD NQFKQIFDNL FDKEYKEKFQ ALKITYEHRL 
251 IDDMVAQMLK SKGGFIIAMK NYDGDVQSDI VAQGFGSLGL MTSILITPDG 
301 KTFESEAAHG TVTRHFRKHQ RGEETSTNSI ASIFAWTRAI IQRGKLDNTD 
351 DVIKFGNLLE KATLDTVQVG GKMTKDLALM LGKTNRSSYV TTEEFIDEVA 

401 KRLQNMMLSS NEDKKGMCKL

(SGD 1997)

Gene Restriction Fragment Map of IDP3:

 

IDP3 PCR Primers:

Forward: 5' ATGAGTAAAATTAAAGTTGTTCAT 3' Tm = 45 C

Reverse: 5' TTATAGTTTGCACATACCTT 3' Tm = 44 C

In Frame Fusion Protein:

HIS HIS HIS HIS HIS HIS MSKIKVVHPI

 

IDP3 Coenzyme:

NADP+

 

Reference Page


Isocitrate Dehydrogenase Main Page

Molecular Biology Main Page

Course Materials

Biology Main Page

College Home Pagesearch


Created by: Elizabeth Shafer. Email questions to lishafer@davidson.edu